View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_low_24 (Length: 390)
Name: NF18196_low_24
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 192 - 374
Target Start/End: Original strand, 52874332 - 52874514
Alignment:
| Q |
192 |
catatatttctattagattcctttttgcacgagatttacaattggttgattttaaattgcccatttcagtggaagttctactatatgctccaactcgtcc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874332 |
catatatttctattagattcctttttgcacgagatttacaattggttgattttgaattgcccatttcagtggaagttctactatatgctccaactcgtcc |
52874431 |
T |
 |
| Q |
292 |
aactatagatttctctgttggatgtttgtggttgatgtctgtcggaacagttatatgtgcttcgttatggtcagacttaactg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874432 |
aactatagatttctctgttggatgtttgtggttgatgtctgtcggaacagttatatgtgcttcgttatggtcagacttaactg |
52874514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University