View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_low_30 (Length: 353)
Name: NF18196_low_30
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_low_30 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 112 - 353
Target Start/End: Complemental strand, 5271291 - 5271050
Alignment:
| Q |
112 |
gtgttgagacagaaaatgggcagtgacaattcaaacgatgatttattgggaggagaagaatgttgtgaaagagaagggaaagggaaaaggttatggaaga |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5271291 |
gtgttgagacagaaaatgggtagtgacaattcaaacgatgatttattgggaggagaagaatgttgtgaaagagaagggaaagggaaaaggttatggaaga |
5271192 |
T |
 |
| Q |
212 |
aggtcaagtatcagcttgttgaatatcattctttgccagcttttctaagagataatgaatacattcttggtcattatcgatctgaatggcctatgaagca |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5271191 |
aggtcaagtatcagcttgttgaatatcattctttgccagcttttctaagagataatgaatacattcttggtcattatcgatctgaatggcctatgaagca |
5271092 |
T |
 |
| Q |
312 |
agttttgcttagtatcttcagaatccacaatgaaactctcaa |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5271091 |
agttttgcttagtatcttcagaatccacaatgaaactctcaa |
5271050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 5271412 - 5271364
Alignment:
| Q |
1 |
cactcttcaaattaacgtaccttttcttctccctttcataaattatctc |
49 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5271412 |
cactctttaaattaacgtaccttttcttctccctttcataaactatctc |
5271364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University