View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_low_45 (Length: 295)
Name: NF18196_low_45
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 22 - 178
Target Start/End: Complemental strand, 13022093 - 13021937
Alignment:
| Q |
22 |
tgtgcctaactcaacctcacaaaaccagcgtgtgaggtgaggaatgttagacaacatgtaatgggcctttggttgtaattgggtcaagggtggtttagtc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13022093 |
tgtgcctaactcaacctcacaaaaccagcgtgtgaggtgaggaatgttagacaacatgtaatgggcctttggttgtaattgggtcaagggtggtttagtc |
13021994 |
T |
|
| Q |
122 |
ttttctagtctttatactctattgtaactcttactttatgtcattgtaccctagccg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13021993 |
ttttctagtctttatactctattgtaactcttactttatgtcattgtaccctagccg |
13021937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 225 - 285
Target Start/End: Complemental strand, 13021941 - 13021881
Alignment:
| Q |
225 |
agccggttttgtggggttcgtattaagcttaagcccaaccacacattctaagatgatgatg |
285 |
Q |
| |
|
||||||||||||||||| ||| ||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
13021941 |
agccggttttgtggggtacgtgttaagtttaagcccaaccacacattctaagattatgatg |
13021881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 64
Target Start/End: Original strand, 30727375 - 30727412
Alignment:
| Q |
27 |
ctaactcaacctcacaaaaccagcgtgtgaggtgagga |
64 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
30727375 |
ctaactcaacctcacaaaaccggcttgtgaggtgagga |
30727412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 23839090 - 23839134
Alignment:
| Q |
20 |
gatgtgcctaactcaacctcacaaaaccagcgtgtgaggtgagga |
64 |
Q |
| |
|
|||| ||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
23839090 |
gatgggcctaacacaacctcacaaaaccggcttgtgaggtgagga |
23839134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University