View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_low_48 (Length: 288)
Name: NF18196_low_48
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 17356012 - 17356249
Alignment:
| Q |
19 |
atcttttagggtttgttgtgatgcttgtgttatatgtttttgctagaattttattattgaaattgattttattgagttaaatcaatgttttgggattttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17356012 |
atcttttagggtttgttgtgatgcttgtgttatatgtttttgctagaattttattattgaaattgattttattgagttaaatcaatattttgggattttg |
17356111 |
T |
|
| Q |
119 |
gagattttgttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagcatata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||| ||| |
|
|
| T |
17356112 |
gagattttgttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgtttttcttcaccttcttgtttgtacaaaagcagc--ata |
17356209 |
T |
|
| Q |
219 |
attgttttggatttttcatgaaaaattattctaaattcat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17356210 |
attgttttggatttttcatgaaaaattattctaaattcat |
17356249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 55 - 213
Target Start/End: Complemental strand, 36620110 - 36619953
Alignment:
| Q |
55 |
tttttgctagaattttattattgaaattgattttattgagttaaatcaatgttttgggattttggagattttgttgatttgtattattgtgtgcttcatg |
154 |
Q |
| |
|
|||||||| ||| ||| ||||||||||| ||||||||||| | |||| | |||||||||||| || ||||||||| || |||| || |||| |||||| |
|
|
| T |
36620110 |
tttttgcttgaaattttttattgaaattaattttattgagctgaatctaggttttgggattt-ggtttttttgttgaattttattgttttgtgtttcatg |
36620012 |
T |
|
| Q |
155 |
cgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagc |
213 |
Q |
| |
|
||||||| |||| | | |||||||||||||||||| ||||||||| || | ||||||| |
|
|
| T |
36620011 |
tgaacttcaattttgcgttttgttgttttccttcactttattgtttctacagaagcagc |
36619953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University