View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_low_49 (Length: 287)
Name: NF18196_low_49
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 32 - 271
Target Start/End: Original strand, 7809188 - 7809427
Alignment:
| Q |
32 |
tgttaataacaattgtggttgggactagtgggttatactcaaataatgtgaggaatcaattttcgaattttggctgaagatgtatttgtatttagtgtct |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7809188 |
tgttaataacaattgtggttgggactagtgggttatactcaaataatgtgaggaatcaatattcgaattttggctgaagatgtatttatatttagtgtct |
7809287 |
T |
 |
| Q |
132 |
gatacacttcgaatataattatttaaagatttgatgcaaatgttaaattgaacttgagagcgaccttaaaatggtcatagtatatgacaagctttgaaat |
231 |
Q |
| |
|
|| || |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
7809288 |
gacacgcttcgaatataattatttaaagatttgatgcaaatgttaagttgaacttgagagcgaccttaaaatggtcatagtgtataacaaactttgaaat |
7809387 |
T |
 |
| Q |
232 |
ggatttacactttgtcttggcatattgagagtgacctttg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7809388 |
ggatttacactttgtcttggcatattgagagtgacctttg |
7809427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University