View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_low_50 (Length: 285)
Name: NF18196_low_50
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 43194825 - 43195103
Alignment:
| Q |
1 |
cctccgtcaacgaaggatcattctcgatagcgcgaatagcagagacaagatcccccgcaacagacggagcagcagaagcagcaacaacatcacttggttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194825 |
cctccgtcaacgaaggatcattctcgatagcgcgaatagcagagacaagatcccccgcaacagacggagcagcagaagcagcaacaacatcacttggttg |
43194924 |
T |
|
| Q |
101 |
agcacaatcaggacacaaccaatcaagcatttcacttgttgttggaacaacagggagacaaggagcatgccatggtgttgtgcaggttttgcaatgaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194925 |
agcacaatcaggacacaaccaatcgagcatttcacttgttgttggaacaacagggagacaaggagcatgccatggtgttgtgcaggttttgcaatgaagt |
43195024 |
T |
|
| Q |
201 |
gtttcggtttctgatggtttttgtttgcagaccatgcatacaccgtcagcgtcacaaggaaggtggtgagtgatgatgt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195025 |
gtttcggtttctgatggtttttgtttgcaaaccatgcatacaccgtcagcgtcacaaggaaggtggtgagtgatgatgt |
43195103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University