View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_low_51 (Length: 280)
Name: NF18196_low_51
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_low_51 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 9420840 - 9420651
Alignment:
| Q |
17 |
aattgggactgccgatagtagttgtgagtcttcattctcaatgtgtacatttttt-ccctttgaatatggatacattcattatttagatgcatatttatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9420840 |
aattgggactgccgatagtagttgtgagtcttccttctcaatctgtacatttttttccctttgaatatggatacatt----atttagatgcatatttatt |
9420745 |
T |
 |
| Q |
116 |
aggtcttgctatttctttttggagcactactataactagggtagtcaataaattattcccacgagttacaaatgtgaaatatgttgaattggtc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9420744 |
aggtcttgctatttctttttggagcactactataactagggtagtcaataaattattcccacgagttacaaatgtcaaatatgttgaattggtc |
9420651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University