View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_low_63 (Length: 237)
Name: NF18196_low_63
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_low_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 26553331 - 26553542
Alignment:
| Q |
1 |
attgcacgttggaaaaacattcagtacaagaatagaaacatttagaaatcagaatacacacatgcgcccatagagacacacaacactagtcagacaaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||| ||||||| ||| |||| |
|
|
| T |
26553331 |
attgcacgttggaaaaacattcagtacaagaatagaaacatt-------cagaatacacacatgcgcgcatacagacacacaaaactagtcggaccaagg |
26553423 |
T |
 |
| Q |
101 |
taaagtacaatacaaagggaaattagttacacatattgtcaaggtaatgtacaatacaaaaaagagaatgacaagatattgcatcaaatgacttgaatct |
200 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26553424 |
taaagtacagtg-aaagggaaattagttacacat--tgtcaaggtaatgtacaattcaaaaaagagaatgacaagatattgcatcaaatgacttgaatct |
26553520 |
T |
 |
| Q |
201 |
ataagccttcaatgatcaacct |
222 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
26553521 |
acaagccttcaatgatcaacct |
26553542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University