View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18197_high_24 (Length: 238)
Name: NF18197_high_24
Description: NF18197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18197_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 20 - 155
Target Start/End: Complemental strand, 41414058 - 41413923
Alignment:
| Q |
20 |
gaagtgtgagtgtgaaaaatgcctcatagcagcatttcaggatcagtgtcttctcccaaggtcgatgtggtcattgacatgggcaatccacttcttaacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41414058 |
gaagtgtgagtgtgaaaaatgcctcatagcagcatttcaggatcagtgtcttctcccaaggtcgatgtggtcattgacatgggcaatccacttcttaacc |
41413959 |
T |
|
| Q |
120 |
tcactgttgatggttttttgaagattggagctgtaa |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41413958 |
tcactgttgatggttttttgaagattggagctgtaa |
41413923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 155
Target Start/End: Complemental strand, 41421304 - 41421174
Alignment:
| Q |
25 |
gtgagtgtgaaaaatgcctcatagcagcatttcaggatcagtgtcttctcccaaggtcgatgtggtcattgacatgggcaatccacttcttaacctcact |
124 |
Q |
| |
|
|||||| ||||| |||||| ||||| ||||| || |||||||||||||| |||| ||||| ||||| |||||||| ||||| | ||||| || || |
|
|
| T |
41421304 |
gtgagtttgaaagatgccttggagcagaatttccggttcagtgtcttctccacaggtggatgttgtcatagacatgggaaatcctttccttaatctagct |
41421205 |
T |
|
| Q |
125 |
gttgatggttttttgaagattggagctgtaa |
155 |
Q |
| |
|
||||||||||| |||||||||||| |||||| |
|
|
| T |
41421204 |
gttgatggtttcttgaagattggaactgtaa |
41421174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University