View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18197_high_24 (Length: 238)

Name: NF18197_high_24
Description: NF18197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18197_high_24
NF18197_high_24
[»] chr2 (2 HSPs)
chr2 (20-155)||(41413923-41414058)
chr2 (25-155)||(41421174-41421304)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 20 - 155
Target Start/End: Complemental strand, 41414058 - 41413923
Alignment:
20 gaagtgtgagtgtgaaaaatgcctcatagcagcatttcaggatcagtgtcttctcccaaggtcgatgtggtcattgacatgggcaatccacttcttaacc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41414058 gaagtgtgagtgtgaaaaatgcctcatagcagcatttcaggatcagtgtcttctcccaaggtcgatgtggtcattgacatgggcaatccacttcttaacc 41413959  T
120 tcactgttgatggttttttgaagattggagctgtaa 155  Q
    ||||||||||||||||||||||||||||||||||||    
41413958 tcactgttgatggttttttgaagattggagctgtaa 41413923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 155
Target Start/End: Complemental strand, 41421304 - 41421174
Alignment:
25 gtgagtgtgaaaaatgcctcatagcagcatttcaggatcagtgtcttctcccaaggtcgatgtggtcattgacatgggcaatccacttcttaacctcact 124  Q
    |||||| ||||| ||||||   ||||| ||||| || ||||||||||||||  |||| ||||| ||||| |||||||| |||||  | ||||| ||  ||    
41421304 gtgagtttgaaagatgccttggagcagaatttccggttcagtgtcttctccacaggtggatgttgtcatagacatgggaaatcctttccttaatctagct 41421205  T
125 gttgatggttttttgaagattggagctgtaa 155  Q
    ||||||||||| |||||||||||| ||||||    
41421204 gttgatggtttcttgaagattggaactgtaa 41421174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University