View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18197_low_14 (Length: 303)
Name: NF18197_low_14
Description: NF18197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18197_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 8 - 289
Target Start/End: Original strand, 43217103 - 43217379
Alignment:
| Q |
8 |
tgagatgaataacggtaagagagtcactttcaccatttatactatcaaaacccctctgatgcgcaagcttcattcacatatagattcctagagctgtgaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43217103 |
tgagatgaataacggtaagagagtcactttcaccatttatactatcaaaacccctctgatgcgcaagcttcattcacatatc----cctagagctgtgaa |
43217198 |
T |
|
| Q |
108 |
gcaaaagtggtacaacaaccgagattttcactgaaacttctgatgaaagcatcggtacgatccctaagcaaacctccacaagaagctttgccatatagat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43217199 |
gcaaaagtggtacaacaaccgagattttcactgaaacttctgatgaaag-atcggtacgatccctaagcaaacctccacaagaagctttgccatatagat |
43217297 |
T |
|
| Q |
208 |
gatgaacaacaccatcaatattgagttttagccactaagcagagggtggacaccaacgaatatcacttgggacatgtaactg |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43217298 |
gatgaacaacaccatcaatattgagttttagccactaagcagagggtggacaccaacgaatatcacttgggacatgtaactg |
43217379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University