View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18197_low_17 (Length: 280)
Name: NF18197_low_17
Description: NF18197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18197_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 14 - 265
Target Start/End: Complemental strand, 32229943 - 32229696
Alignment:
| Q |
14 |
tatcatatcgaaagtcaaggtaatagtagagtaacatgagttaaatatctccttaaggaacttattttcacccacacacatgttatatatgttatatcat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32229943 |
tatcatatcgaaagtcaaggtaatagtagaggaacatgagttaaatatctccttaaggaatttattttcacccacacacatgttat----gttatatcat |
32229848 |
T |
 |
| Q |
114 |
tatttcaatcttattagccaaccaatggactgtcaaactcaaagtcacgatcgatcttgatgtgtgcttttctatatcatcaaaatagaatggtagtttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32229847 |
tatttcaatcttattagccaaccaatggactgtcaaactcaaagtcacgatcgatcttgatgtgtgcttttctatatcatcaaaatagaatggtagtttt |
32229748 |
T |
 |
| Q |
214 |
catatacgttttgatggttttaaacttgtgaaacttcaagcattgtcgaaaa |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32229747 |
catatacgttttgatggttttaaacttgtgaaacttcaagcattgtcgaaaa |
32229696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University