View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18197_low_6 (Length: 423)
Name: NF18197_low_6
Description: NF18197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18197_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 7e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 7e-90
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 48019435 - 48019207
Alignment:
| Q |
1 |
aagtttgcttaaacacattgaaaaattacttttgagtttttcagtattcaaatctcacccggaaaacacaatcaaacattttcggtgtgccgtgtatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019435 |
aagtttgcttaaacacattgaaaaattacttttgagtttttcagtattcaaatctcacccggaaaacacaatcaaacattttcgg--------------- |
48019351 |
T |
|
| Q |
101 |
attggaaaacgcaagcaattgtttcctgttccgatttgtaatctggattctggaaaattgatatctacgtatctatgaagattttatttacggaaaactc |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
48019350 |
-----aaaacgcaagcaattgtttccggttccgatttgtaatctggattctggaaaattgatatctacgtatctatgaagagtttgtttacggaaaactc |
48019256 |
T |
|
| Q |
201 |
atacatctttctccggtgaatacttgtttttcggaacactattaccacc |
249 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019255 |
atagatctttctccggtgaatacttgtttttcggaacactattaccacc |
48019207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 326 - 404
Target Start/End: Complemental strand, 48019095 - 48019017
Alignment:
| Q |
326 |
ctgttgtactaattcttttccattttttcagtggcacattgcaacgaaccacgactagacgaggaagaggttcatgatc |
404 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019095 |
ctgttgcactaattcttttccattttttcagtggcacattgcaacgaaccacgactagacgaggaagaggttcatgatc |
48019017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University