View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18198_high_24 (Length: 237)
Name: NF18198_high_24
Description: NF18198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18198_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 53032255 - 53032476
Alignment:
| Q |
1 |
tttaactctcttcgtaaccaaaactaatcatacttaattcttttaattttcctcttaatggaaattgaacaacaactaccaatgatcaagtctaggttca |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53032255 |
tttaactctcttcataaccaaaactaatcatacttaattcttttaattttcctcttaatggaaattgaacaacaactatcaatgatcaagtctaggttca |
53032354 |
T |
 |
| Q |
101 |
aacgcatctgtgtttattgtggtagcacccctggaaaaaacccgagctaccaaattgctgctattcaacttggaaaacaactggcaagtatccattcatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53032355 |
aacgcatctgtgtttattgtggtagcacccctggaaaaaacccgagctaccaaattgctgctattcaacttggaaaacaactggcaagtatccattcatg |
53032454 |
T |
 |
| Q |
201 |
ttcatattcaaatataaaaatt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53032455 |
ttcatattcaaatataaaaatt |
53032476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University