View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18198_high_5 (Length: 364)
Name: NF18198_high_5
Description: NF18198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18198_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 17 - 347
Target Start/End: Original strand, 16738323 - 16738651
Alignment:
| Q |
17 |
gtgcatctgatcctgttgctgttgtagccttgttgaaagaacttggtgccagnnnnnnnttaagcacaataattgaaggggaatccgtgatgaatgatgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16738323 |
gtgcatctgatcctgttgctgttgtagccttgttgaaagaactgggtgccagcaaaaaattaagcacaataattgaaggggaatccgtgatgaatgatgg |
16738422 |
T |
 |
| Q |
117 |
gtactttgtttagatcccttgactcttgttttcaccaacgttcttcccttcaaatgaattaccaaatttgctattaaatttaggttgtaggaagtagctt |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16738423 |
gtactttgtttaga-cccttgactcttgttttcaccaacgttcttcccttcagatga-ttaccaaatttgctattaaatttaggttgtaggaagtagctt |
16738520 |
T |
 |
| Q |
217 |
aaagccttgatcatttataatgagtgactatttctgcatgcgatggttcttttagatgttttttatttggtcttctagaaagcttaatctttgttcttgt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16738521 |
aaagccttgatcatttataatgagtgactatttctgcatgtgatggttcttttagatgttttttatttggtcttctagaaagcttaatctttgttcttgt |
16738620 |
T |
 |
| Q |
317 |
ccagggtggctattgtggtttataccctttt |
347 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
16738621 |
ccagggtggctattgtggtttatactctttt |
16738651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University