View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18198_low_14 (Length: 299)
Name: NF18198_low_14
Description: NF18198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18198_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 83 - 284
Target Start/End: Original strand, 53032010 - 53032208
Alignment:
| Q |
83 |
ctctctcattattaaattaaatttagaaatagtagaaagcaaaactagagatactataaagagggataagcaatgacacaaattgttattcacttttgga |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53032010 |
ctctctcattattaaattaaatttagaaatagtagaaagtaaaactagagatactataaagagggataagcaatgacacaaattgttattcacttttgga |
53032109 |
T |
|
| Q |
183 |
tattgggatttcaaagtgattgctgactctttgcttccttgttccgctttcttttcctcattattcccttttcacatcacttcattactactacatacat |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53032110 |
tattgggatttcaaagtgattgctgactctttgcttccttgttctgctttcttttcttcattattcccttttcacatcacttc---actactacatacat |
53032206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University