View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18198_low_20 (Length: 250)
Name: NF18198_low_20
Description: NF18198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18198_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 41 - 86
Target Start/End: Original strand, 1835869 - 1835914
Alignment:
| Q |
41 |
tatgatatggctaattaagtgactcaactaccgatcacttgtgtca |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1835869 |
tatgatatggctaattaagtgactcaactaccgatcacttgtgtca |
1835914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 1834589 - 1834632
Alignment:
| Q |
1 |
catatatttttatatagacacatcagttagacattgaaattatg |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1834589 |
catatatttttatatagacacatcagttagacattgaaattatg |
1834632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University