View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18198_low_27 (Length: 221)

Name: NF18198_low_27
Description: NF18198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18198_low_27
NF18198_low_27
[»] chr5 (1 HSPs)
chr5 (20-207)||(42572073-42572261)


Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 42572261 - 42572073
Alignment:
20 cacgataaaagtacgataaagagttgttttaaaagttatccaaaatgattcattactcttttgtaaaatacacacaaaatcaaaataatattgcatgtga 119  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42572261 cacgataaaaatacgataaagagttgttttaaaagttatccaaaatgattcattactcttttgtaaaatacacacaaaatcaaaataatattgcatgtga 42572162  T
120 tattaaaattttgatgtaaatatatatctttgcacattgactctttgatctcacttaaac-ttgatttgcatattacgaccatgtttat 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
42572161 tattaaaattttgatgtaaatatatatctttgcacattgactctttgatctcacttaaacgttgatttgcatattacgaccatgtttat 42572073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University