View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18199_high_12 (Length: 262)

Name: NF18199_high_12
Description: NF18199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18199_high_12
NF18199_high_12
[»] chr1 (1 HSPs)
chr1 (15-245)||(37162126-37162356)


Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 245
Target Start/End: Complemental strand, 37162356 - 37162126
Alignment:
15 aaccatcaggaatagtcattcaaaattgccacattgtggccgatactcacaatgtgaaattcgacaacaaagcctatcttgcgcgtccgtggaagaattt 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
37162356 aaccatcaggaatagtcattcaaaattgccacattgtggccgatactcacaatgtgaaattcgacaacaaagcctatcttgcgcgtccatggaagaattt 37162257  T
115 ctcaaggactgttttcataaaaacttacattggagatttgattcagccagatgggtttatgccatggcaaggaccaaatggtactgtttctggcattgac 214  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37162256 ctcaaggactgttttcatgaaaacttacattggagatttgattcagccagatgggtttatgccatggcaaggaccaaatggtactgtttctggcattgac 37162157  T
215 acttgtttttatgctgagtataataataaag 245  Q
    |||||||||||||||||||||||||||||||    
37162156 acttgtttttatgctgagtataataataaag 37162126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University