View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18199_low_14 (Length: 262)
Name: NF18199_low_14
Description: NF18199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18199_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 245
Target Start/End: Complemental strand, 37162356 - 37162126
Alignment:
| Q |
15 |
aaccatcaggaatagtcattcaaaattgccacattgtggccgatactcacaatgtgaaattcgacaacaaagcctatcttgcgcgtccgtggaagaattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37162356 |
aaccatcaggaatagtcattcaaaattgccacattgtggccgatactcacaatgtgaaattcgacaacaaagcctatcttgcgcgtccatggaagaattt |
37162257 |
T |
|
| Q |
115 |
ctcaaggactgttttcataaaaacttacattggagatttgattcagccagatgggtttatgccatggcaaggaccaaatggtactgtttctggcattgac |
214 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37162256 |
ctcaaggactgttttcatgaaaacttacattggagatttgattcagccagatgggtttatgccatggcaaggaccaaatggtactgtttctggcattgac |
37162157 |
T |
|
| Q |
215 |
acttgtttttatgctgagtataataataaag |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37162156 |
acttgtttttatgctgagtataataataaag |
37162126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University