View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18199_low_16 (Length: 251)
Name: NF18199_low_16
Description: NF18199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18199_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 82 - 186
Target Start/End: Original strand, 44546011 - 44546115
Alignment:
| Q |
82 |
ctaaaagtagaaatactttgctcagcttatctcttgtcacatctgcgtttctccaacatcacacgcatgacgcaatgcaacacaggttacaggtatcacc |
181 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44546011 |
ctaaaagtagaaatactttgctaagcttatctcttgtcacatctgcgtttctccaacatcacacgcatgacgcaatgcaacacaggttacaggtttcacc |
44546110 |
T |
 |
| Q |
182 |
tatac |
186 |
Q |
| |
|
||||| |
|
|
| T |
44546111 |
tatac |
44546115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 24 - 85
Target Start/End: Original strand, 44545136 - 44545197
Alignment:
| Q |
24 |
tatttggtttgagggcacgaccagacaagtatcgtctgtagtttggtttatttaggatctaa |
85 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44545136 |
tatttggtttgagggcacgacctgacaagtatcgtctgtagtttggtttatttaggatctaa |
44545197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University