View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18199_low_17 (Length: 225)
Name: NF18199_low_17
Description: NF18199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18199_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 20296196 - 20296001
Alignment:
| Q |
14 |
gcataggtggagactagggtgcaccacttttgatgatgtatgtcagtgcaccacctgttatgaagcaatgacacgaacaccaaacacgacactgacaagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20296196 |
gcataggtggagactagggtgcaccacttttgatgatgtatgtcagtgcaccacctgttatgaagcaatgacacgaacaccaaacacgacactgacaagg |
20296097 |
T |
|
| Q |
114 |
acacgttgacactggtgataacttgacatatgtgaatgcaatcatatattaaaaaccattaaaacaaatcagttatctacagctctactttacatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20296096 |
acacgttgacactggtgataacttgacatatgtgaatgcaatcacatattaaaaaccattaaaacaaatcagttatctacacctctactttacatg |
20296001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 90 - 127
Target Start/End: Complemental strand, 14779532 - 14779495
Alignment:
| Q |
90 |
acaccaaacacgacactgacaaggacacgttgacactg |
127 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14779532 |
acaccaaacacgacactgacgtggacacgttgacactg |
14779495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University