View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18200_low_16 (Length: 387)
Name: NF18200_low_16
Description: NF18200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18200_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 9109440 - 9109211
Alignment:
| Q |
1 |
aaacttaaggaggatgatcaaacacaaactagtagtatatatagttggtttaacatttt-gtgattaaggtgatgcaactctatatcttaaatagttgca |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9109440 |
aaacttaag-aggatgatcaaacacaaactagtagtatatatagtcggtttaacatttttgtgattaaggtgatgcaactctatatcttaaatagttgca |
9109342 |
T |
 |
| Q |
100 |
cttgcacaataatgatggtacttgcttgtcaacgagatgtatgaaaattactatagagcgttggatatggttaggcaacgtgagattagatcctgtcatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9109341 |
cttgcacaataatgatggtacttgcttgtcaacgagatgtatgaaaattactatagagcgttggataaggttaggcaacgtgagattagatcctgtcatg |
9109242 |
T |
 |
| Q |
200 |
ttcaaattacaaatgagcaaacattatttcc |
230 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
9109241 |
ttaaaattacaaatgagcaaacattatttcc |
9109211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 371
Target Start/End: Complemental strand, 9109104 - 9109072
Alignment:
| Q |
339 |
catcaaaactagacattttacaaatatgtatat |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9109104 |
catcaaaactagacattttacaaatatgtatat |
9109072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University