View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18200_low_22 (Length: 339)
Name: NF18200_low_22
Description: NF18200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18200_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 322
Target Start/End: Complemental strand, 38944808 - 38944507
Alignment:
| Q |
19 |
gttgaactttggaagctcaaagatattaattactaatttatggtgatattgttgggattattaaatttgccactatattgaaatgtgctagctagtgaat |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
38944808 |
gttgaactttggaagttcaaagatattaattactaatttatggtgatattgttgggattattaaatttgccgctatattgaaatgtgctagctagtg--t |
38944711 |
T |
|
| Q |
119 |
tgaaagttgcaacaactctatccaatttttgactcaattatttaatattggttccccattcaatgcaggtgatgagaaagccttagcagacgatgttgcc |
218 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38944710 |
tgaaagttgtaacaactctatccaatttttgactcaattatttaatattggttccccattcaatgcaggtgatgagaaagccttagcagacgatgttgca |
38944611 |
T |
|
| Q |
219 |
gttgatgcagaaggcaatgcatatgttactgatgtaaaagcaagtaaaatatggaaagttggggttgatggaaaccttatatcaatcattagaaacccac |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38944610 |
gttgatgcagaaggcaatgcatatgttactgatgtaaaagcaagtaaaatatggaaagttggggttggtggaaaccttatatcaatcattagaaacccac |
38944511 |
T |
|
| Q |
319 |
tatt |
322 |
Q |
| |
|
|||| |
|
|
| T |
38944510 |
tatt |
38944507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University