View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18200_low_25 (Length: 326)
Name: NF18200_low_25
Description: NF18200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18200_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 289
Target Start/End: Complemental strand, 12318416 - 12318146
Alignment:
| Q |
18 |
agtctctagtattggcattatgcttccaatcatcatctaatgacccgccatgcttcataaagaattttgtaaaatatagaaatgcataaattcaactggg |
117 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12318416 |
agtctctactgttggcattatgcttccaaccatcatctaatgacc-gccatgcttcataaagaattttgtaaaatatagaaatgcataaattcaactggg |
12318318 |
T |
 |
| Q |
118 |
aattgtttaatgagttttacacataaaagctagcagtagagattaatttagtgctcagaataaacaagtataccagttcataacagattcaaatttctaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12318317 |
cattgtttaatgagttttacacataaaagctagcagtagagattaatttagtgctcagaataaacaagtataccagttcataacatattcaaatttctaa |
12318218 |
T |
 |
| Q |
218 |
aaacaataaataaatggaaggatagaacctgttctcagttgtgaaggtggtctgtgtggttaccgtcggaca |
289 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
12318217 |
aaacaataaacaaatggaaggatcgaacctgttctcaggtttgaaggtggtctgtgtggttaccgtcggaca |
12318146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 125 - 180
Target Start/End: Complemental strand, 34593068 - 34593013
Alignment:
| Q |
125 |
taatgagttttacacataaaagctagcagtagagattaatttagtgctcagaataa |
180 |
Q |
| |
|
|||||| ||| ||||||| || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
34593068 |
taatgaatttcacacatagaaactagcagtagagattagtttagtgctcagaataa |
34593013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University