View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18200_low_37 (Length: 241)
Name: NF18200_low_37
Description: NF18200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18200_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 39396187 - 39396410
Alignment:
| Q |
1 |
taattgagattttgttgaagtttcaaagtgcagttttttgctaaaatcacggtggcacaacttaaatattccaaacacacaactccaatgtttggtattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39396187 |
taattgagattttgttgaagtttcaaagtgcagttttttgctaaaatcacggtggcacaacttaaatattccaaacacactactccaatgtttggtattc |
39396286 |
T |
|
| Q |
101 |
ctttctcacgtccctatgcgcttccactgggaaattaaagaagctaggaattgtggagtttgctgaaagcgcgtcttcatcatgaaaatccaactttaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396287 |
ctttctcacgtccctatgcgcttccactgggaaattaaagaagctaggaattgtggagtttgttgaaagcgcgtcttcatcatgaaaatccaactttaca |
39396386 |
T |
|
| Q |
201 |
aacacacacgctaccaatccaaac |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39396387 |
aacacacacgctaccaatccaaac |
39396410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 55
Target Start/End: Complemental strand, 17899511 - 17899465
Alignment:
| Q |
8 |
gattttgttgaagtttcaaagtgcagttttttgctaaaatcacggtgg |
55 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
17899511 |
gattttgttgaagtttcaaagtatag-tttttgctaaaatcacggtgg |
17899465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University