View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18200_low_38 (Length: 239)
Name: NF18200_low_38
Description: NF18200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18200_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 35692883 - 35693093
Alignment:
| Q |
13 |
tgaagctatatttcacaaatacgagttttattgagtaaatcatcatcatcttgatcctcgaaattaatattgtaagagtcgagcgatttagtcccacaag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35692883 |
tgaagctatatttcacaaatacgagttttattgagtaaatcatcatcatcttggtcctcgaaattaatattgtaagagtcgagcgatttagtccctcaag |
35692982 |
T |
 |
| Q |
113 |
tttatgaaatagaaaatgggtccctcgaattaaagaaatgcaatcaatgtggtttttccatcattatatttctttggttaacatccatcaaaaccaacaa |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
35692983 |
tttatgaaatagaaaatgtgtccctcgaagtaaagaaatgcaatcaatgtggtttttccatcattatatttctttggttaacatccatcaaaacaatcaa |
35693082 |
T |
 |
| Q |
213 |
aggacatacat |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
35693083 |
aggacatacat |
35693093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University