View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18200_low_40 (Length: 228)
Name: NF18200_low_40
Description: NF18200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18200_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 218
Target Start/End: Original strand, 43514186 - 43514385
Alignment:
| Q |
19 |
ttaggatcatccaagtttatttcataatttataaccatactaggagatgcaacataacattgattaacagataagaatcacttgatatttatctataaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43514186 |
ttaggatcatccaagtttatttcataatttataaccatactaggagatgcaacataacattgattaacagataagaatcacttgatatttatctataaca |
43514285 |
T |
 |
| Q |
119 |
gaaagagaaaatgacatatggactaaccttagaaaatccattcacggttagagttttaccccacatccctggtaaagatgcaaagctagtctgtgctgct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||| |
|
|
| T |
43514286 |
gaaagagaaaatgacatatggactaaccttagaaaatccattcacggttagagttttaccccacatccccggtaaagatgcaaagctagtgtgtgttgct |
43514385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 118 - 218
Target Start/End: Original strand, 38103912 - 38104012
Alignment:
| Q |
118 |
agaaagagaaaatgacatatggactaaccttagaaaatccattcacggttagagttttaccccacatccctggtaaagatgcaaagctagtctgtgctgc |
217 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||| ||||||||||||||| || |||||| | ||||||||||||||||| || |||| ||| |
|
|
| T |
38103912 |
agaaagagaacatgacatacaaactaaccttagaaaatccgttcacggttagagttctattccacattctaggtaaagatgcaaagcttgtatgtgttgc |
38104011 |
T |
 |
| Q |
218 |
t |
218 |
Q |
| |
|
| |
|
|
| T |
38104012 |
t |
38104012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University