View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18200_low_42 (Length: 215)

Name: NF18200_low_42
Description: NF18200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18200_low_42
NF18200_low_42
[»] chr2 (1 HSPs)
chr2 (18-200)||(7414024-7414206)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 7414024 - 7414206
Alignment:
18 agtacttcttggccagatgttggtggcacttatgatagtttctgtcagagaccatgggaaaagcatggaatttgcacaccattcagccagtatgattact 117  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7414024 agtacttcttggccagatgttggtggcacttgtgatagtttctgtcagagaccatgggaaaagcatggaatttgcacaccattcagccagtatgattact 7414123  T
118 ttcgccacaccttatatctatggtatactcacaatgtcacagttatggtggatgagaaaaatatcagacccgggacacctatg 200  Q
    || | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
7414124 tttgtcacaccttatatctatggtatattcacaatgtcacagttatggtggatgagaaaaatatcaaacccgggacacctatg 7414206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University