View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18200_low_9 (Length: 499)
Name: NF18200_low_9
Description: NF18200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18200_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 2e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 242 - 484
Target Start/End: Original strand, 9569409 - 9569647
Alignment:
| Q |
242 |
aaaataatgattcgacgagaatgtaaaaaaggatattgtaacccttgaatataaaattcttcaatatcagggttggaataagtgttttaaggtgtttatt |
341 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
9569409 |
aaaataatgattctacgagaatgtaaaaaaggatattgtaacccttgaatataaaattcttcaatattagggttggaataagtgttttcaggtgtttatt |
9569508 |
T |
|
| Q |
342 |
tgggttcagttaattgtgggaagagaatgtgtgctggcagagggttttgatggnnnnnnnnnnnnnnnnngtacgagtagcggacgataggtgtttagaa |
441 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9569509 |
tgggttcag----ttgtgggaagagaatgtgtgctggcagagggttttgatggttttttggagttttttggtacgagtagcggacgataggtgtttagaa |
9569604 |
T |
|
| Q |
442 |
cttgttttggtagccatcaactagttgggtagtgtatttagtg |
484 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9569605 |
cttgttttggtagccatcaactagttgggtggtgtatttagtg |
9569647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 24 - 191
Target Start/End: Original strand, 9569191 - 9569358
Alignment:
| Q |
24 |
acagagaggtctcgtttatctacactttatgacacctcaaatgttccttcaattaaggatagatttactgtttgaaatatgcttgtaggggttagtagtc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
9569191 |
acagagaggtctcgtttatctacactttatgacacatcaaacgttccttcaattgaggatagattcactctttgaaatatgcttgtaggggttagtagtc |
9569290 |
T |
|
| Q |
124 |
ccaaggatttttcaacccagcctgaatgcataaatttcgaatcttttggatgaacgatgcttagagcc |
191 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9569291 |
ccaaggattttgcaacccagcctgaatgcataaatttcgaatcttttggatgaacgatgcttagagcc |
9569358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University