View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18203_low_2 (Length: 295)
Name: NF18203_low_2
Description: NF18203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18203_low_2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 18 - 295
Target Start/End: Complemental strand, 31274903 - 31274625
Alignment:
| Q |
18 |
gatttgtcttgtgttttctatttcaagcaacatgagaatctttaggcacttatttttgtacatgatttccatttcctatttggtattt-ggacagctatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
31274903 |
gatttgtcttgtgttttctatttcaagcaacatgagaatctttaggcacttatttttgtacatgatttccatttcctatttggtgttttggacagctatt |
31274804 |
T |
|
| Q |
117 |
caatatgctttgatggggtatgaaggaccacttcactttgatggaattgataatttcttgcaccatgggatgacctttaaagaaaataaggacaaaacat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31274803 |
caatatgctttgatggggtatgaaggaccacttcacattgatggaattgataatttcttgcaccatgggatgacctttaaaggaaataaggacaaaacat |
31274704 |
T |
|
| Q |
217 |
attattcggttgtttgttgtatggtcattattatgaacccctcatctttagaacgagtttggatctctccataatgtac |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31274703 |
attattcggttgtttgttgtatggtcattattatgaacccctcatctttagaacgagtttggatctctccataatgtac |
31274625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University