View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18204_low_4 (Length: 246)
Name: NF18204_low_4
Description: NF18204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18204_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 229
Target Start/End: Complemental strand, 6486313 - 6486096
Alignment:
| Q |
12 |
atgaagacacacctccacagaattcactaatcggttcactggttcgcgaagagggtcacatttattctttagccgcttccggtgacttattatacaccgg |
111 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6486313 |
atgaagacacgcctccacagaattcactaattggttcactggtccgcgaagagggtcacatttattctttagccgcatccggtgacttattatacaccgg |
6486214 |
T |
|
| Q |
112 |
ttcagacagcaagaacattcgtgtgtggaagaatcttcaagaatattgcggattcaaatccaacagtggactggtgaaagcaatcataatatccggtcaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486213 |
ctcagacagcaagaacattcgtgtgtggaagaatcttcaagaatattgcggattcaaatccaacagtggactggtgaaagcaatcataatatccggtcaa |
6486114 |
T |
|
| Q |
212 |
aagatcttcactggtcac |
229 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6486113 |
aagatcttcactggtcac |
6486096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 41 - 129
Target Start/End: Complemental strand, 25703404 - 25703316
Alignment:
| Q |
41 |
atcggttcactggttcgcgaagagggtcacatttattctttagccgcttccggtgacttattatacaccggttcagacagcaagaacat |
129 |
Q |
| |
|
||||| ||||| | ||||||||| |||||||| || || ||||||| |||||||||| | |||||||||||| | || ||||| ||||| |
|
|
| T |
25703404 |
atcgggtcactagctcgcgaagaaggtcacatctactccttagccgtttccggtgacatgttatacaccggtaccgatagcaaaaacat |
25703316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 98 - 146
Target Start/End: Complemental strand, 6917703 - 6917655
Alignment:
| Q |
98 |
ttattatacaccggttcagacagcaagaacattcgtgtgtggaagaatc |
146 |
Q |
| |
|
||||||||||||||||| || || || ||||||||||| |||||||||| |
|
|
| T |
6917703 |
ttattatacaccggttctgatagtaaaaacattcgtgtttggaagaatc |
6917655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University