View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18205_low_7 (Length: 528)
Name: NF18205_low_7
Description: NF18205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18205_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 7e-78; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 335 - 518
Target Start/End: Complemental strand, 16822974 - 16822791
Alignment:
| Q |
335 |
gccggtgattttgtgcaaccaatgacggctaccaaattcaattccttcttgattttgcgcatgtgatttgatagattttctgttaaattagtaagatttt |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16822974 |
gccggtgattttgtgcaaccaatgacggctaccaaattcaattccttcttgattttgcgcatgtgatttgatagattttctgttaaattagtaagatttt |
16822875 |
T |
 |
| Q |
435 |
gattagtgatttcattttggatagata--tattcattgtgttcaaagcatgatatataatattctctattttatcatcgtcttcat |
518 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
16822874 |
gattagtgatttcattttggatagatatctattcattgttaacaaagcatg--atataatattctctattttatcttcgtcttcat |
16822791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 209 - 289
Target Start/End: Complemental strand, 16823099 - 16823019
Alignment:
| Q |
209 |
cgtattgagagggtgcaattgcattaaatggtggtttaattgcattgcttgctactcaggggagagagaaagagacgcgcc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16823099 |
cgtattgagagggtgcaattgcattaaatggtggtttaattgcattgcttgctactcaggggagagagaaagagacgcgcc |
16823019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 29 - 125
Target Start/End: Complemental strand, 16823280 - 16823185
Alignment:
| Q |
29 |
taaacttgttgagaaaagaagagagatcctggttttgagaaggttaaaatgggaatnnnnnnngtgaaaggttagaagaaagaaacggttgtttttt |
125 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16823280 |
taaacttgttgagaaaagaagagagatgctggttttgagaaggttaaaatgggaat-aaaaaagtgaaaggttagaagaaagaaacggttgtttttt |
16823185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University