View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18206_low_4 (Length: 251)
Name: NF18206_low_4
Description: NF18206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18206_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 43796497 - 43796723
Alignment:
| Q |
17 |
attatgcctaaagatagtctgcatgaagagaaacaaactatgttcagtttaaacatactaaagtgggactctcgagtctcgattcaacatccactcactc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43796497 |
attatgcctaaagatagtctgcatgaagagaaacaaactatgttcagtttcaacatactaaagtgggactctcgagtctcgattcaacatccactcactc |
43796596 |
T |
|
| Q |
117 |
aggtttggacatctaaagagtggattaatgcagaaggaatacaaaggatcacaagaattacatacagaaaaactacgaaacagttaaacacctgtacatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43796597 |
aggtttggacatctaaagagtggattaatgcagaaggaatacaaaggatcacaaaaattacatacagaaaaactacgaaacagttaaacacctgtacatt |
43796696 |
T |
|
| Q |
217 |
cttttccactgcttgccttttcatctc |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43796697 |
cttttccactgcttgccttttcatctc |
43796723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University