View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18207_high_14 (Length: 283)
Name: NF18207_high_14
Description: NF18207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18207_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 99 - 269
Target Start/End: Original strand, 4645858 - 4646028
Alignment:
| Q |
99 |
atctattgcaacttgctaaaaccnnnnnnntaaataaataattggtagctgaaaaatggccacacatttgttgaattgaatgaagcaattgtgcaaaaat |
198 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4645858 |
atctattgcaacttgctaaaaccaaaaaaataaataaataattggtagctgaaaaatggccacacatttgttgaattgaatgaagctattgtgcaaaaat |
4645957 |
T |
 |
| Q |
199 |
gttgcatgtggttgaaaataagttcagatacaaaatattgatggagattgtgaccatcaattgaagtttgt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4645958 |
gttgcatgtggttgaaaataagttcagatacaaaatattgatggagattgtgaccatcaattgaagtttgt |
4646028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University