View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18207_high_16 (Length: 238)
Name: NF18207_high_16
Description: NF18207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18207_high_16 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 93 - 238
Target Start/End: Complemental strand, 25049431 - 25049285
Alignment:
| Q |
93 |
ctcagtttttcgccagaatagatttattattgttgttgaatgtggaactagtaaatatgactgattaattacttaggatagatataaattaattaaacaa |
192 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25049431 |
ctcagtttttcgctagaatagatttattattgttgttgaatgtggaactagtaaatatgactgattaattacttaggatagatataaattaattaaacaa |
25049332 |
T |
|
| Q |
193 |
caaaattacatttatgaattgcaacattga-ttgtttgcttgtctcc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
25049331 |
caaaattacatttatgaattgcaacattaatttgtttgcttgtctcc |
25049285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University