View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18208_high_10 (Length: 326)
Name: NF18208_high_10
Description: NF18208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18208_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 21 - 289
Target Start/End: Complemental strand, 3706330 - 3706062
Alignment:
| Q |
21 |
caggcaacgtgggaatggctatagctcaaaccatcctaacacaagacctagtcgacgagcttgttcttgttgacaccattcctgacaaactacgaggtga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3706330 |
caggcaacgtgggaatggctatagctcaaaccatcctaacacaagacctagtcgacgagcttgttcttgttgacgccattcctgacaaactacgaggtga |
3706231 |
T |
 |
| Q |
121 |
gatgctagatctacaacatgctgcggccttcctcccccgtactaagatccaggcctccactgactattcagtgacgatggggtctgacctctgcatcgtc |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
3706230 |
gatgctggatctacaacatgctgcggccttcctcccccgcactaagatccaggcctccactgactattcagtgacgatgggttccgacctctgcatcgtc |
3706131 |
T |
 |
| Q |
221 |
actgctggggctcgccagattaatggcgagtccagattgaatttgctacaaaggaatgtagctttgttt |
289 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3706130 |
actgctggggctcgtcagattaatggcgagtccagattgaatttgctacaaaggaatgtagctttgttt |
3706062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University