View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18208_high_12 (Length: 287)
Name: NF18208_high_12
Description: NF18208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18208_high_12 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 146 - 287
Target Start/End: Complemental strand, 6291510 - 6291369
Alignment:
| Q |
146 |
ttgttgtgatgaatattgtcattgtgaggaaggaagacaaaagattctaggataccaaaatggaagggaatatatagatatagatatagaggtattgttg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6291510 |
ttgttgtgatgaatattgtcattgtgaggaaggaagagaaaagattctaggataccaaaatggaagggaatatatagatatagatatagaggtattgttg |
6291411 |
T |
 |
| Q |
246 |
aaaggattagaattcctttcttttcttgtttgaattaatatt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6291410 |
aaaggattagaattcctttcttttcttgtttgaattaatatt |
6291369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 6291655 - 6291574
Alignment:
| Q |
1 |
tctatataatttcaaattaatcaatgaattagtactaaatattgtacaagttatagtaattcttagagttaaaaatttaagg |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6291655 |
tctatataatttcaaattaatcaatgaattagtactaaatattgtacaagttatagtaattcttagagttaaaaatttaagg |
6291574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University