View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18208_high_20 (Length: 239)
Name: NF18208_high_20
Description: NF18208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18208_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 6817425 - 6817309
Alignment:
| Q |
16 |
cagtgggaatacaagtggtataaggtaaagagtatttctccatttttaattatttgtcttctct----tatagtttagaaatcttcacaaactagcaatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6817425 |
cagtgggaatacaagtggtataaggtaaagagtatttctccatttttaattatttgtcttctcttatatatagtttagaaatcttcacaaactagcaatt |
6817326 |
T |
|
| Q |
112 |
tgtcatgtcacatagga |
128 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6817325 |
tgtcatgtcacatagga |
6817309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 119
Target Start/End: Complemental strand, 6809285 - 6809183
Alignment:
| Q |
16 |
cagtgggaatacaagtggtataaggtaaagagtatttctccatttttaattatttgtcttctcttatagtttagaaatcttcacaaactagcaatttgtc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||| |||||| | || | |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
6809285 |
cagtgggaatacaagtggtataaggtaaagattatttctccatatttagttatttaccctc-cctataatttagaaattttcacaaactagcaatttgtc |
6809187 |
T |
|
| Q |
116 |
atgt |
119 |
Q |
| |
|
|||| |
|
|
| T |
6809186 |
atgt |
6809183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 239
Target Start/End: Complemental strand, 6817292 - 6817257
Alignment:
| Q |
204 |
tgaaccaagccgcactgagaaaaccgaactgtaatt |
239 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6817292 |
tgaaccaagccgcactgagaaaaccaaactgtaatt |
6817257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University