View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18208_low_11 (Length: 315)
Name: NF18208_low_11
Description: NF18208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18208_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 9 - 297
Target Start/End: Complemental strand, 3431273 - 3430985
Alignment:
| Q |
9 |
caataatattatgagttagacatgatttatgaaatgtattaagcaacctttattacaatgttttctacccttatttctagaaaaacttgataacaccatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3431273 |
caataatattatgagttagacatgatttatgaaatgtattaagcaacctttattacaatgttttctacccttatttctagaaaaacttgataacaccatg |
3431174 |
T |
 |
| Q |
109 |
gcatacatgtttgtcatatcatatgttctctaggctaataatggtcttagacaaattgccttgttattcagggctgacttttcgggacgaatatatgtca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3431173 |
gcatacatgtttgtcatatcatatgttctctaggctaataatggtcttagacaaattgccttgttattcagggctgacttttcgggacgaatatatgtca |
3431074 |
T |
 |
| Q |
209 |
aaagttgtaactgctctgagtcaacaagttcattgttgaataaggctttattactctttttgcatttttatttaaggtcatgctaacat |
297 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3431073 |
aaagttgtaactgctccgagtcaacaagttcattgttgaataaggctttattactctttttgcatttttatttaaggtcatgctaacat |
3430985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University