View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18208_low_16 (Length: 277)
Name: NF18208_low_16
Description: NF18208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18208_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 12832461 - 12832268
Alignment:
| Q |
16 |
aatattcaaaagtaagtgacgtctaaaacaaattttgatatatgaacccccgttttctttg--agcaaaatgagaccctttttatgtaaatatgacacct |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
12832461 |
aatattcaaaagtaagtgatgtctaaaacaaattttgatatatgagccccctttttctttttcagcaaaatgagaccctttttatctaaatatgacgcct |
12832362 |
T |
|
| Q |
114 |
ttttaaaatttaaagaaaaattattttgtttggaggcttaaaatgaaggttttagtggttttatccttggaccgaccctgctaaagacacgtgt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||| || |||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12832361 |
ttttaaaatttaaagaaaaattattttgttcgtaggttttaaatgagggttttagtcgttttatccttggaccgaccctgctaaagacacgtgt |
12832268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 12839268 - 12839072
Alignment:
| Q |
16 |
aatattcaaaagtaagtgacgtctaaaacaaattttgatatatgaacccccgttttcttt--gagcaaaatgagacccttttt---atgtaaatatgaca |
110 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| |||| ||||| |||||||| ||||||||||||||||||||| || |||||||||| |
|
|
| T |
12839268 |
aatattcaaaagtaagtgatgcctaaaacaaattttgatacatgagccccctttttctttttgagcaaaatgagacccttttttttatctaaatatgacg |
12839169 |
T |
|
| Q |
111 |
cctttttaaaatttaaagaaaaattattttgtttggaggcttaaaatgaaggttttagtggttttatccttggaccgaccctgctaaagacacgtgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||| || | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12839168 |
cctttttaaaatttaaagaaaaattattttgttcgtaggcttaaaacgagagctttagtggttttatccttggaccgaccctgctaaagacacgtgt |
12839072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 233 - 276
Target Start/End: Complemental strand, 12832242 - 12832199
Alignment:
| Q |
233 |
aattacttcacatatatttatattgtgacaaagaagaactctaa |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12832242 |
aattacttcacatatatttatattgtgacaaagaaaaactctaa |
12832199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 181
Target Start/End: Complemental strand, 41873164 - 41873102
Alignment:
| Q |
119 |
aaatttaaagaaaaattattttgtttggaggcttaaaatgaaggttttagtggttttatcctt |
181 |
Q |
| |
|
|||||||| |||||||||||||||| | ||| |||| |||| | |||||||||| |||||||| |
|
|
| T |
41873164 |
aaatttaaggaaaaattattttgttggtaggtttaatatgaggattttagtggtcttatcctt |
41873102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 60
Target Start/End: Original strand, 25817697 - 25817734
Alignment:
| Q |
23 |
aaaagtaagtgacgtctaaaacaaattttgatatatga |
60 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
25817697 |
aaaaataagtgacgtctaaaacaagttttgatatatga |
25817734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University