View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18208_low_22 (Length: 245)
Name: NF18208_low_22
Description: NF18208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18208_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 29536363 - 29536147
Alignment:
| Q |
14 |
aaggtaaggggtggatagtttgattgattcatgtatttagcgatgtgtaggacgaacacgactgtctaaattatagtgcattgaatccctcatgtaggaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29536363 |
aaggtaaggggtggatagtttgattgattcatgtatttagcgatgtgtaggacgaacacgactgtctaaattatagtgcattgaatccctcatgtaggaa |
29536264 |
T |
 |
| Q |
114 |
acactacatttgcggtggtaaatattgaatgtcatgttttcaataaatcatggtagatggaaaagactaaccagtttgttgttctttgatgatggggtat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
29536263 |
acactacatttgcggtggtaaatattgaatgtcatgttttcaataaatcatggtagatggaaaagactaatcagtttgttgttctttgatgattgggtat |
29536164 |
T |
 |
| Q |
214 |
tatttatgttacttgtg |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29536163 |
tatttatgttacttgtg |
29536147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University