View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18208_low_25 (Length: 231)
Name: NF18208_low_25
Description: NF18208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18208_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 35 - 214
Target Start/End: Complemental strand, 33127189 - 33127009
Alignment:
| Q |
35 |
catactagagtcctaactaaatatt-gcttcaaaccgttcatacatggctttagaagttaaaaagatggcaatatcaagagaagtatcaacaattatatg |
133 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33127189 |
catactagagtcctaactaaatatttgcttcaaaccgttcatacatggctttagaagttaaaaagatggcaatatcaagagaattatcaacaattatatg |
33127090 |
T |
 |
| Q |
134 |
gctagtctcgtggagtcttattatgatctatcatgttagtttagccgaaagagttttggaagacgaaaaaccagaaattgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127089 |
gctagtctcgtggagtcttattatgatctatcacgttagtttagccgaaagagttttggaagacgaaaaaccagaaattgt |
33127009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University