View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18211_high_18 (Length: 359)
Name: NF18211_high_18
Description: NF18211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18211_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 55385072 - 55384734
Alignment:
| Q |
1 |
ctagaaatgctcgagtcaataccaagcaaacctcttcccatcataatgtctcggtaatattgattgtcaaatattgttggggtcatgtcattaggcacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55385072 |
ctagaaatgctcgagtcaataccaagcaaacctcttcccatcataatgtctcggtaatattgattgtcaaatattgttggggtcatgtcattaggcacaa |
55384973 |
T |
|
| Q |
101 |
atgttaggtttgtcataggaataacagttgggcatgctagtcttagtgaggtttcataacccaaattcatattgtttcctatctgttgattttgattata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55384972 |
atgttaggtttgtcataggaataacagttgggcatgctagtcttagtgaggtttcataacccaaattcatattgtttcctatctgttgattttgattata |
55384873 |
T |
|
| Q |
201 |
caatctgccaacaatgcttaagcagtgtccaacacctaatgtatgtgcacctgtaaaataataatagtaacagatcaaaaaatatatattgcttgtctta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55384872 |
caatctgccaacaatgcttaagcagtgtccaacacctaatgtatgtgcacctgtaaaataataatagtaacagatcaaaaa----ctattgcttgtctta |
55384777 |
T |
|
| Q |
301 |
ggtaacagtttttatctgtattaattagtataacactttaaat |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55384776 |
ggtaacagtttttatctgtattaattagtataacactttaaat |
55384734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University