View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18211_high_19 (Length: 343)
Name: NF18211_high_19
Description: NF18211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18211_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 18 - 330
Target Start/End: Complemental strand, 26954953 - 26954636
Alignment:
| Q |
18 |
ttagccttggtggatgaccttgctactgctctt-----cgatgatttccacaagatgaggttggaactctagtagacaatgtgagcagatgtgtagtcat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954953 |
ttagccttggtggatgaccttgctactgctctttgcttcgatgatttccacaagatgaggttggaactctagtagacaatgtgagcagatgtgtagtcat |
26954854 |
T |
|
| Q |
113 |
ctttattatcagtccaatcagtatccttatatgcaatgagtgtagaagaattctgtttccgaagaaaaaggccatgaaaattgtacctttgaggcggcgc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| || |
|
|
| T |
26954853 |
ctttattatcagtccaatcagtatccttatatgcaatgagtgtagaagaattctgtttccgaagaaaaaggccatgaaaattgtacctctgatgcggtgc |
26954754 |
T |
|
| Q |
213 |
agaatcctctttagaggagtcaaatgagtggtagtgaatctttgcacgaactaagaaagattatattaacagtaaatgcaatgtcaggtcatgtcatgga |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26954753 |
agaatcctctttagaggagtcaaatgagtggtagtggatctttgcacgaactaagaaagattatattaacagtaaatgcaatgtcaggtcatgtcatgga |
26954654 |
T |
|
| Q |
313 |
taagtattgagactgtct |
330 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
26954653 |
taagtattgacactgtct |
26954636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University