View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18211_high_24 (Length: 228)

Name: NF18211_high_24
Description: NF18211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18211_high_24
NF18211_high_24
[»] chr4 (1 HSPs)
chr4 (8-149)||(22199847-22199988)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 8 - 149
Target Start/End: Complemental strand, 22199988 - 22199847
Alignment:
8 agtgagatgaatatatgatggatggatgcccattagtcattggatcaaacagatggcctattaattcattcctgaactcttgtatttctctataattaaa 107  Q
    |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
22199988 agtgtgatgaatatattatggatggatgcccattagtcattggatcaaacagatggcctattaattcattcccgaactcttgtatttctctataattaaa 22199889  T
108 tatggttcattcgtaatagaatcatatacataaaaaatacta 149  Q
    | ||||||||||||||||||||||||||||||||||||||||    
22199888 tttggttcattcgtaatagaatcatatacataaaaaatacta 22199847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University