View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18211_low_26 (Length: 228)
Name: NF18211_low_26
Description: NF18211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18211_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 8 - 149
Target Start/End: Complemental strand, 22199988 - 22199847
Alignment:
| Q |
8 |
agtgagatgaatatatgatggatggatgcccattagtcattggatcaaacagatggcctattaattcattcctgaactcttgtatttctctataattaaa |
107 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22199988 |
agtgtgatgaatatattatggatggatgcccattagtcattggatcaaacagatggcctattaattcattcccgaactcttgtatttctctataattaaa |
22199889 |
T |
 |
| Q |
108 |
tatggttcattcgtaatagaatcatatacataaaaaatacta |
149 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22199888 |
tttggttcattcgtaatagaatcatatacataaaaaatacta |
22199847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University