View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18212_low_3 (Length: 426)
Name: NF18212_low_3
Description: NF18212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18212_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 51296591 - 51296894
Alignment:
| Q |
1 |
tcatcaataaatgtacattagaatgacaaggtagtgaggtaccattttaaattggaatatcattcctgcagcatcttgtacaagaaccaatgtttatcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51296591 |
tcatcaataaatgtacattagaatgagaaggt--------accattttaaattggaatatcattcctgcagcatcttgtacaagaaccaatgtttatcct |
51296682 |
T |
 |
| Q |
101 |
ttgaatcgcatggcttctaagtagcacaaagctactttcagtgtcgggaataacacacaattatatttgtcacttcttggttcttcttacatcatttcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51296683 |
ttgaatcgcatggcttctaagtagcacaaagctactttcagtgtcgggaataacactcaattatatttgtcacttcttggttcttcttacatcatttcac |
51296782 |
T |
 |
| Q |
201 |
ccaaaattttatgctatatgtttggtaaactataatacatgtaaccaacaattcactttttctccacatggaatgaatttttactacttttattggaaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51296783 |
ccaaaattttatgctatatgtttggtaaactatagtacatataaccaacaattcactttttccccacatggaatgaatttttactacttttattggaaat |
51296882 |
T |
 |
| Q |
301 |
ttcttagaggtg |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51296883 |
ttcttagaggtg |
51296894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 335 - 408
Target Start/End: Original strand, 51297218 - 51297291
Alignment:
| Q |
335 |
gatgcaattagtcgatcaccgtctgatgatgatcatgtgattgattactggaaggatacactttggtatgttgg |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51297218 |
gatgcaattagtcgatcaccgtctgatgatgatcatgtgattgattactggaaggatacactttggtatgttgg |
51297291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University