View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18213_high_21 (Length: 233)
Name: NF18213_high_21
Description: NF18213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18213_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 30629527 - 30629733
Alignment:
| Q |
18 |
cttatgagtttatgctttcttccgattttgtgttgtaaattaaacattttaattttatgctatggttataatgtagattagggaccaatttgtgattggt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30629527 |
cttatgagtttatgctttcttccgattttgtgttgtatattaaacattttaattttatgatatggttataatgtagattagggaccaacttgtgattggt |
30629626 |
T |
 |
| Q |
118 |
ttgagacttgagtggtaaggaactcgagtactttaaacaagtggtcagaagtttgatttgtgactcttgtatttgaagaaaatctagttggaagagaata |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
30629627 |
ttgagatttgagtggtaaggaactcgagtactttaaacaagtggtcagaagtttgatttacgactcttgtatttgaagaaaatctaattggaagagaaga |
30629726 |
T |
 |
| Q |
218 |
atctacc |
224 |
Q |
| |
|
|| |||| |
|
|
| T |
30629727 |
atttacc |
30629733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 181
Target Start/End: Original strand, 34329597 - 34329631
Alignment:
| Q |
147 |
actttaaacaagtggtcagaagtttgatttgtgac |
181 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
34329597 |
actttaaacaagtggtcagatgtttgatttgtgac |
34329631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University