View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18213_high_22 (Length: 233)
Name: NF18213_high_22
Description: NF18213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18213_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 7333421 - 7333217
Alignment:
| Q |
18 |
tcttccccacacctttcatccccacaattgaaagtgtggaaggattactaccgctccctgtggtcaactttgagaccaaatctcgttcttcttttttaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||| |||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
7333421 |
tcttccccacacctttcatccccacaatggaaagtgcggaaggattactaccactccctgaggtcaactttgagaccaaatcttgctcttcttttttaca |
7333322 |
T |
 |
| Q |
118 |
accaactaatttggttgactcctgtctatcaatggtgcaagtttttattaatttatcaagaagattgatagcatttcctatctgactttgatattccaca |
217 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||| || | |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7333321 |
accaactaatttggttgactcctgtcttttgatggtgcaagtttttattaaattctgaagaagattgatagcatttcctatctcactttgatattccaca |
7333222 |
T |
 |
| Q |
218 |
ggttc |
222 |
Q |
| |
|
||||| |
|
|
| T |
7333221 |
ggttc |
7333217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University