View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18213_low_13 (Length: 291)
Name: NF18213_low_13
Description: NF18213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18213_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 2116321 - 2116565
Alignment:
| Q |
1 |
agcacagattcatagcttggattttagtatctgagtctttcttcaatgattcacaccaatagcagttgcacacacaaactggtactcatgctgtatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2116321 |
agcacagattcatagcttggattttagtatctgagtctttcttcaatgattcacaccaatagcacttgcacacacaaactggtactcatgctgtatgatt |
2116420 |
T |
 |
| Q |
101 |
gaattgatgaacttcagcttctagatttggttatgctatatgctaatatctgtgatggnnnnnnnncataaattaatgaatatataaaatatttattagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2116421 |
gaattgatgaacttcagcttctagatttggttatgctatatgctaatatctgtgatggaaaaaaaacataaattaatgaatatataaaatatttattagc |
2116520 |
T |
 |
| Q |
201 |
atgcaaatatttattacacattactaggctaacctttttcaaacc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2116521 |
atgcaaatatttattacacattactaggctaacctttttcaaacc |
2116565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University